About FORGEdb
Summary and number of annotations for rs1421085 (FORGEdb score=9):
RefSeq closest gene data: 1
UCSC genome browser data: 1
CADD v1.6 annotations: 3
GTEx cis-eQTLs: 2
eQTLGen blood cis-eQTLs: 0
ABC contacts: 2
FORGE2-TF motifs: 4
CATO score: 0
FORGE2 consolidated roadmap DNase I hotspots (erc2-DHS): 4
FORGE2 consolidated roadmap H3 histone marks (erc2-H3-all): 46
FORGE2 unconsolidated roadmap DNase I hotspots (erc): 22
FORGE2 blueprint DNase I hotspots (blueprint): 0
FORGE2 ENCODE DNase I hotspots (encode): 22
FORGE2 consolidated roadmap chromatin states (erc2-15state): 127



FORGEdb
RefSeq closest gene information (hg19, for more details, see NCBI RefSeq):
chr start end rsid chr2 start2 end2 gene name
chr16 53,800,953 53,800,954 rs1421085 chr16 53,738,095 54,145,709 FTO



FORGEdb
UCSC genome browser link (hg19):
hgTracks?db=hg19&position=chr16%3A53800954-53800954



FORGEdb
CADD v1.6 annotations at SNP coordinates in hg19 (note that none or several variants may be shown at this position):
chromosome position reference_allele alternative_allele raw_CADD_score PHRED_score
16 53,800,954 T A 1.874217 18.76
16 53,800,954 T C 1.890281 18.88
16 53,800,954 T G 1.865506 18.70



FORGEdb
GTEx cis-eQTL information (for more details, see https://gtexportal.org/home/):
gene symbol gene ID variant ID gene ID2 TSS distance reference allele alternative allele MA samples MA count MAF p-value nominal slope slope se p-value nominal threshold min p-value nominal p-value beta biosample chr (hg38) variant position (hg38) num alternative alleles per site rs ID dbSNP151 GRCh38p7 variant ID b37
FTO ENSG00000140718 chr16_53767042_T_C_b38 ENSG00000140718.20 65,350 T C 417 501 0.354816 7.52477e-08 0.142105 0.0261122 0.000128491 5.15667e-17 5.76599e-13 Muscle_Skeletal.v8.signif_variant_gene_pairs.txt chr16 53,767,042 1 rs1421085 16_53800954_T_C_b37
IRX3 ENSG00000177508 chr16_53767042_T_C_b38 ENSG00000177508.11 -519721 T C 177 206 0.337705 8.31466e-06 0.365211 0.0802374 4.54538e-05 6.09846e-10 2.72929e-06 Pancreas.v8.signif_variant_gene_pairs.txt chr16 53,767,042 1 rs1421085 16_53800954_T_C_b37



FORGEdb
eQTLGen blood FDR 0.05 cis-eQTL information (hg19, for more details, see https://www.eqtlgen.org):
Gene Symbol p-value rsid SNP Chromosome SNP Position Assessed Allele Other Allele Z-score Gene ID Gene Chromosome Gene Position Number of Cohorts Number of Samples FDR Bonferroni p-value



FORGEdb
Activity-By-Contact (ABC) information (hg19, for more details, see https://www.engreitzlab.org/resources):
SNP chromosome SNP start SNP end rsid bait chromosome bait start bait end name class activity base TargetGene TargetGeneTSS TargetGeneExpression TargetGenePromoterActivityQuantile TargetGeneIsExpressed distance isSelfPromoter Hi-C contact powerlaw contact powerlaw contact reference Hi-C contact pl scaled Hi-C pseudocount Hi-C contact pl scaled adj ABC Score Numerator ABC Score powerlaw Score Numerator powerlaw Score CellType base overlap
chr16 53,800,953 53,800,954 rs1421085 chr16 53,800,452 53,801,125 genic|chr16:53800302-53801275 genic 4.244537 RPGRIP1L 53,737,850 NA 0.679281 True 62938.5 False 0.004504 0.013672 0.013632 0.004491 0.001216 0.005707 0.024224 0.021728 0.057861 0.029409 HCT116-ENCODE 1
chr16 53,800,953 53,800,954 rs1421085 chr16 53,800,452 53,801,125 genic|chr16:53800302-53801275 genic 4.244537 FTO 53,737,874 NA 0.679526 True 62914.5 False 0.004504 0.013676 0.013636 0.004491 0.001216 0.005707 0.024224 0.021728 0.057881 0.029417 HCT116-ENCODE 1



FORGEdb
FORGE2-TF motif information (hg19, for more details, see FORGE2-TF, eFORGE-TF and the FORGE2 main paper):
chr start end rsid chr2 start2 end2 TF motif name p-value strand genomic sequence
chr16 53,800,953 53,800,954 rs1421085 chr16 53,800,938 53,800,961 TFAP2C_ONECUT2_AP2_HomeoCut_474 3.74856e-06 - GGTCCTAAGGCATGATATTGATT
chr16 53,800,953 53,800,954 rs1421085 chr16 53,800,952 53,800,970 MEIS2_ONECUT2_HomeoMEIS_HomeoCut_189 1.74247e-06 - ATATTGATTAAGTGTCTG
chr16 53,800,953 53,800,954 rs1421085 chr16 53,800,952 53,800,970 MEIS2_ONECUT2_HomeoMEIS_HomeoCut_624 1.45893e-06 - ATATTGATTAAGTGTCTG
chr16 53,800,953 53,800,954 rs1421085 chr16 53,800,953 53,800,969 MEIS1_ONECUT2_HomeoMEIS_HomeoCut_188 2.61932e-06 - TATTGATTAAGTGTCT



FORGEdb
CATO (contextual analysis of TF occupancy) score (coordinates in hg19, for more details, see http://www.mauranolab.org/CATO/):
chr start end rsid CATO score strand TF motif score1 allele1 allele2 score2 biosample



FORGEdb
FORGE2 rs1421085.erc2-DHS:
Cell Tissue Datatype Variant rsid
E005 H1 BMP4 Derived Trophoblast Cultured Cells ES Cell DNase I hotspot rs1421085
E006 H1 Derived Mesenchymal Stem Cells ES Cell DNase I hotspot rs1421085
E080 Fetal Adrenal Gland Fetal Adrenal Gland DNase I hotspot rs1421085
E089 Fetal Muscle Trunk Fetal Muscle Trunk DNase I hotspot rs1421085



FORGEdb
FORGE2 rs1421085.erc2-H3-all:
Cell Tissue Datatype Variant rsid
E032 Primary B cells from peripheral blood Blood H3K36me3 rs1421085
E033 Primary T cells from cord blood Blood H3K36me3 rs1421085
E034 Primary T cells from peripheral blood Blood H3K36me3 rs1421085
E051 Primary hematopoietic stem cells G-CSF-mobili Blood H3K36me3 rs1421085
E028 Breast variant Human Mammary Epithelial Cells Breast H3K4me1 rs1421085
E028 Breast variant Human Mammary Epithelial Cells Breast H3K4me3 rs1421085
E003 H1 Cells ES Cell H3K36me3 rs1421085
E004 H1 BMP4 Derived Mesendoderm Cultured Cells ES Cell H3K4me1 rs1421085
E004 H1 BMP4 Derived Mesendoderm Cultured Cells ES Cell H3K4me3 rs1421085
E004 H1 BMP4 Derived Mesendoderm Cultured Cells ES Cell H3K36me3 rs1421085
E005 H1 BMP4 Derived Trophoblast Cultured Cells ES Cell H3K4me1 rs1421085
E005 H1 BMP4 Derived Trophoblast Cultured Cells ES Cell H3K9me3 rs1421085
E006 H1 Derived Mesenchymal Stem Cells ES Cell H3K4me1 rs1421085
E006 H1 Derived Mesenchymal Stem Cells ES Cell H3K4me3 rs1421085
E006 H1 Derived Mesenchymal Stem Cells ES Cell H3K36me3 rs1421085
E007 H1 Derived Neuronal Progenitor Cultured Cells ES Cell H3K4me1 rs1421085
E008 H9 Cells ES Cell H3K4me3 rs1421085
E085 Fetal Intestine Small Fetal Intestine Small H3K36me3 rs1421085
E080 Fetal Adrenal Gland Fetal Adrenal Gland H3K4me1 rs1421085
E082 Fetal Brain Female Fetal Brain H3K36me3 rs1421085
E083 Fetal Heart Fetal Heart H3K4me1 rs1421085
E084 Fetal Intestine Large Fetal Intestine Large H3K4me1 rs1421085
E084 Fetal Intestine Large Fetal Intestine Large H3K36me3 rs1421085
E086 Fetal Kidney Fetal Kidney H3K4me1 rs1421085
E086 Fetal Kidney Fetal Kidney H3K4me3 rs1421085
E090 Fetal Muscle Leg Fetal Muscle Leg H3K36me3 rs1421085
E089 Fetal Muscle Trunk Fetal Muscle Trunk H3K4me1 rs1421085
E092 Fetal Stomach Fetal Stomach H3K4me1 rs1421085
E093 Fetal Thymus Fetal Thymus H3K9me3 rs1421085
E094 Gastric Gastric H3K4me1 rs1421085
E021 iPS DF 6.9 Cells IPS cell H3K36me3 rs1421085
E017 IMR90 fetal lung fibroblasts Cell Line Lung H3K4me1 rs1421085
E017 IMR90 fetal lung fibroblasts Cell Line Lung H3K9me3 rs1421085
E097 Ovary Ovary H3K4me1 rs1421085
E097 Ovary Ovary H3K9me3 rs1421085
E097 Ovary Ovary H3K36me3 rs1421085
E098 Pancreas Pancreas H3K4me1 rs1421085
E100 Psoas Muscle Psoas Muscle H3K4me1 rs1421085
E055 Foreskin Fibroblast Primary Cells skin01 Skin H3K4me1 rs1421085
E056 Foreskin Fibroblast Primary Cells skin02 Skin H3K4me1 rs1421085
E056 Foreskin Fibroblast Primary Cells skin02 Skin H3K27me3 rs1421085
E056 Foreskin Fibroblast Primary Cells skin02 Skin H3K36me3 rs1421085
E057 Foreskin Keratinocyte Primary Cells skin02 Skin H3K4me1 rs1421085
E057 Foreskin Keratinocyte Primary Cells skin02 Skin H3K9me3 rs1421085
E057 Foreskin Keratinocyte Primary Cells skin02 Skin H3K36me3 rs1421085
E109 Small Intestine Small Intestine H3K4me1 rs1421085



FORGEdb
FORGE2 rs1421085.erc:
Cell Tissue Datatype Variant rsid
Mesenchymal_Stem_Cells ES Cell DNase I hotspot rs1421085
Mesenchymal_Stem_Cells ES Cell DNase I hotspot rs1421085
Fetal_Heart Fetal Heart DNase I hotspot rs1421085
Fetal_Heart Fetal Heart DNase I hotspot rs1421085
Fetal_Intestine_Large Fetal Intestine, Large DNase I hotspot rs1421085
Fetal_Intestine_Small Fetal Intestine, Small DNase I hotspot rs1421085
Fetal_Lung_Left Fetal Lung DNase I hotspot rs1421085
Fetal_Muscle_Arm Fetal Muscle DNase I hotspot rs1421085
Fetal_Muscle_Arm Fetal Muscle DNase I hotspot rs1421085
Fetal_Muscle_Arm Fetal Muscle DNase I hotspot rs1421085
Fetal_Muscle_Arm Fetal Muscle DNase I hotspot rs1421085
Fetal_Muscle_Leg Fetal Muscle DNase I hotspot rs1421085
Fetal_Muscle_Leg Fetal Muscle DNase I hotspot rs1421085
Fetal_Muscle_Leg Fetal Muscle DNase I hotspot rs1421085
Fetal_Muscle_Leg Fetal Muscle DNase I hotspot rs1421085
Fetal_Muscle_Lower_Limb_Skeletal Fetal Muscle DNase I hotspot rs1421085
Fetal_Muscle_Trunk Fetal Muscle DNase I hotspot rs1421085
Fibroblasts_Fetal_Skin_Abdomen Fibroblast DNase I hotspot rs1421085
Fibroblasts_Fetal_Skin_Quadriceps_Left Fibroblast DNase I hotspot rs1421085
Fibroblasts_Fetal_Skin_Quadriceps_Left Fibroblast DNase I hotspot rs1421085
Fibroblasts_Fetal_Skin_Upper_Back Fibroblast DNase I hotspot rs1421085
Penis_Foreskin_Fibroblast Fibroblast DNase I hotspot rs1421085



FORGEdb
FORGE2 rs1421085.blueprint:
Cell Tissue Datatype Variant rsid



FORGEdb
FORGE2 rs1421085.encode:
Cell Tissue Datatype Variant rsid
AoAF Blood vessel DNase I hotspot rs1421085
HBMEC Blood vessel DNase I hotspot rs1421085
HMVEC-dBl-Ad Blood vessel DNase I hotspot rs1421085
HMVEC-dBl-Neo Blood vessel DNase I hotspot rs1421085
HMVEC-dNeo Blood vessel DNase I hotspot rs1421085
HMVEC-LBl Blood vessel DNase I hotspot rs1421085
HA-h Brain hippocampus DNase I hotspot rs1421085
HeLa-S3 Cervix DNase I hotspot rs1421085
HCT-116 Colon DNase I hotspot rs1421085
WI-38 Embryonic lung DNase I hotspot rs1421085
WI-38 Embryonic lung DNase I hotspot rs1421085
HAEpiC Epithelium DNase I hotspot rs1421085
HNPCEpiC Epithelium DNase I hotspot rs1421085
HCFaa Heart DNase I hotspot rs1421085
HCF Heart DNase I hotspot rs1421085
8988T Liver DNase I hotspot rs1421085
AG04450 Lung DNase I hotspot rs1421085
HSMM Muscle DNase I hotspot rs1421085
PrEC Prostate DNase I hotspot rs1421085
AG09309 Skin DNase I hotspot rs1421085
NHDF-Ad Skin DNase I hotspot rs1421085
HA-sp Spinal cord DNase I hotspot rs1421085



FORGEdb
FORGE2 rs1421085.erc2-chromatin15state-all:
Cell Tissue Datatype Variant rsid
E063 Adipose Nuclei Adipose Quies rs1421085
E080 Fetal Adrenal Gland Adrenal Enh rs1421085
E029 Primary monocytes from peripheral blood Blood Quies rs1421085
E030 Primary neutrophils from peripheral blood Blood Quies rs1421085
E031 Primary B cells from cord blood Blood TxWk rs1421085
E032 Primary B cells from peripheral blood Blood Quies rs1421085
E033 Primary T cells from cord blood Blood TxWk rs1421085
E034 Primary T cells from peripheral blood Blood Quies rs1421085
E035 Primary hematopoietic stem cells Blood TxWk rs1421085
E036 Primary hematopoietic stem cells short term culture Blood Quies rs1421085
E037 Primary T helper memory cells from peripheral blood 2 Blood Quies rs1421085
E038 Primary T helper naive cells from peripheral blood Blood TxWk rs1421085
E039 Primary T helper naive cells from peripheral blood Blood Quies rs1421085
E040 Primary T helper memory cells from peripheral blood 1 Blood Quies rs1421085
E041 Primary T helper cells PMA-I stimulated Blood TxWk rs1421085
E042 Primary T helper 17 cells PMA-I stimulated Blood Quies rs1421085
E043 Primary T helper cells from peripheral blood Blood Quies rs1421085
E044 Primary T regulatory cells from peripheral blood Blood Quies rs1421085
E045 Primary T cells effector/memory enriched from peripheral blood Blood Quies rs1421085
E046 Primary Natural Killer cells from peripheral blood Blood Quies rs1421085
E047 Primary T CD8+ naive cells from peripheral blood Blood Quies rs1421085
E048 Primary T CD8+ memory cells from peripheral blood Blood Quies rs1421085
E050 Primary hematopoietic stem cells G-CSF-mobilized Female Blood Quies rs1421085
E051 Primary hematopoietic stem cells G-CSF-mobilized Male Blood Quies rs1421085
E062 Primary mononuclear cells from peripheral blood Blood Quies rs1421085
E115 Dnd41 TCell Leukemia Blood Quies rs1421085
E116 GM12878 Lymphoblastoid Blood Quies rs1421085
E123 K562 Leukemia Blood Quies rs1421085
E124 Monocytes-CD14+ RO01746 Primary Cells Blood Quies rs1421085
E129 Osteoblast Primary Cells Bone Enh rs1421085
E067 Brain Angular Gyrus Brain TxWk rs1421085
E068 Brain Anterior Caudate Brain TxWk rs1421085
E069 Brain Cingulate Gyrus Brain Enh rs1421085
E070 Brain Germinal Matrix Brain Quies rs1421085
E071 Brain Hippocampus Middle Brain TxWk rs1421085
E072 Brain Inferior Temporal Lobe Brain Quies rs1421085
E073 Brain_Dorsolateral_Prefrontal_Cortex Brain TxWk rs1421085
E074 Brain Substantia Nigra Brain TxWk rs1421085
E081 Fetal Brain Male Brain Quies rs1421085
E082 Fetal Brain Female Brain Quies rs1421085
E125 NH-A Astrocytes Primary Cells Brain Enh rs1421085
E119 HMEC Mammary Epithelial Primary Cells Breast Enh rs1421085
E117 HeLa-S3 Cervical Carcinoma Cervix Enh rs1421085
E075 Colonic Mucosa Digestive Quies rs1421085
E077 Duodenum Mucosa Digestive TxWk rs1421085
E079 Esophagus Digestive TxWk rs1421085
E084 Fetal Intestine Large Digestive TxWk rs1421085
E085 Fetal Intestine Small Digestive Quies rs1421085
E092 Fetal Stomach Digestive Quies rs1421085
E094 Gastric Digestive TxWk rs1421085
E101 Rectal Mucosa Donor 29 Digestive TxWk rs1421085
E102 Rectal Mucosa Donor 31 Digestive TxWk rs1421085
E106 Sigmoid Colon Digestive Enh rs1421085
E109 Small Intestine Digestive TxWk rs1421085
E110 Stomach Mucosa Digestive TxWk rs1421085
E122 HUVEC Umbilical Vein Endothelial Primary Cells Endothelial Enh rs1421085
E027 Breast Myoepithelial Primary Cells Epithelial Enh rs1421085
E028 Breast variant Human Mammary Epithelial Cells (vHMEC) Epithelial Enh rs1421085
E055 Foreskin Fibroblast Primary Cells skin01 Epithelial Enh rs1421085
E056 Foreskin Fibroblast Primary Cells skin02 Epithelial Enh rs1421085
E057 Foreskin Keratinocyte Primary Cells skin02 Epithelial Enh rs1421085
E058 Foreskin Keratinocyte Primary Cells skin03 Epithelial Enh rs1421085
E059 Foreskin Melanocyte Primary Cells skin01 Epithelial Quies rs1421085
E061 Foreskin Melanocyte Primary Cells skin03 Epithelial TxWk rs1421085
E126 NHDF-Ad Adult Dermal Fibroblast Primary Cells Epithelial Enh rs1421085
E127 NHEK-Epidermal Keratinocyte Primary Cells Epithelial Enh rs1421085
E001 ES-I3 ESC TxWk rs1421085
E002 ES-WA7 ESC Quies rs1421085
E003 H1 ESC Quies rs1421085
E008 H9 ESC Quies rs1421085
E014 HUES48 ESC Quies rs1421085
E015 HUES6 ESC Quies rs1421085
E016 HUES64 ESC Quies rs1421085
E024 ES-UCSF4 ESC Quies rs1421085
E004 H1 BMP4 Derived Mesendoderm Cultured ES-derived Quies rs1421085
E005 H1 BMP4 Derived Trophoblast Cultured ES-derived Enh rs1421085
E006 H1 Derived Mesenchymal Stem Cells ES-derived TxWk rs1421085
E007 H1 Derived Neuronal Progenitor Cultured ES-derived Quies rs1421085
E009 H9 Derived Neuronal Progenitor Cultured ES-derived TxWk rs1421085
E010 H9 Derived Neuron Cultured ES-derived TxWk rs1421085
E011 hESC Derived CD184+ Endoderm Cultured ES-derived Quies rs1421085
E012 hESC Derived CD56+ Ectoderm Cultured ES-derived Enh rs1421085
E013 hESC Derived CD56+ Mesoderm Cultured ES-derived Enh rs1421085
E065 Aorta Heart TxWk rs1421085
E083 Fetal Heart Heart Quies rs1421085
E095 Left Ventricle Heart TxWk rs1421085
E104 Right Atrium Heart TxWk rs1421085
E105 Right Ventricle Heart TxWk rs1421085
E018 iPS-15b iPSC Quies rs1421085
E019 iPS-18 iPSC Quies rs1421085
E020 iPS-20b iPSC Quies rs1421085
E021 iPS DF 6.9 iPSC Quies rs1421085
E022 iPS DF 19.11 iPSC Quies rs1421085
E086 Fetal Kidney Kidney Quies rs1421085
E066 Liver Liver Quies rs1421085
E118 HepG2 Hepatocellular Carcinoma Liver TssAFlnk rs1421085
E017 IMR90 fetal lung fibroblasts Lung Enh rs1421085
E088 Fetal Lung Lung Quies rs1421085
E096 Lung Lung Quies rs1421085
E114 A549 EtOH 0.02pct Lung Carcinoma Lung Enh rs1421085
E128 NHLF Lung Fibroblast Primary Cells Lung Enh rs1421085
E023 Mesenchymal Stem Cell Derived Adipocyte Cultured Mesenchymal Enh rs1421085
E025 Adipose Derived Mesenchymal Stem Cell Cultured Mesenchymal Enh rs1421085
E026 Bone Marrow Derived Cultured Mesenchymal Stem Cells Mesenchymal TxWk rs1421085
E049 Mesenchymal Stem Cell Derived Chondrocyte Cultured Mesenchymal Enh rs1421085
E052 Muscle Satellite Cultured Muscle Enh rs1421085
E089 Fetal Muscle Trunk Muscle Quies rs1421085
E090 Fetal Muscle Leg Muscle Quies rs1421085
E100 Psoas Muscle Muscle TxWk rs1421085
E107 Skeletal Muscle Male Muscle TxWk rs1421085
E108 Skeletal Muscle Female Muscle Enh rs1421085
E120 HSMM Skeletal Muscle Myoblasts Muscle TxWk rs1421085
E121 HSMM cell derived Skeletal Muscle Myotubes Muscle TxWk rs1421085
E053 Cortex derived primary cultured neurospheres Neurosphere TxWk rs1421085
E054 Ganglion Eminence derived primary cultured neurospheres Neurosphere TxWk rs1421085
E097 Ovary Ovary Enh rs1421085
E087 Pancreatic Islets Pancreas Quies rs1421085
E098 Pancreas Pancreas TxWk rs1421085
E091 Placenta Placenta Quies rs1421085
E099 Placenta Amnion Placenta Quies rs1421085
E076 Colon Smooth Muscle Smooth Muscle TxWk rs1421085
E078 Duodenum Smooth Muscle Smooth Muscle TxWk rs1421085
E103 Rectal Smooth Muscle Smooth Muscle TxWk rs1421085
E111 Stomach Smooth Muscle Smooth Muscle Quies rs1421085
E113 Spleen Spleen Quies rs1421085
E093 Fetal Thymus Thymus Quies rs1421085
E112 Thymus Thymus Quies rs1421085